EST 1206488 is a singleton


Sequence

>1206488 (1 EST) Length=291 GAAAAAAGAAAAAAGAAACGAAAAGTGGGCTTCAGCAAGGAACGCATAAGGGTTTTCTCAGGAGGGCAACTGCGTGGTAA ATGCAGAAACGAACAATGGATTGGAAAGGATGACAATAATGTAACAATTGAGAATACCCCATGCCGGACNATCTGACAAC AACACAGAGGGGGAAGTAGGGAAAGAGAGGAATGAGGACCCATCCTGCAGAAAATGTGAAGGTAATAGTAAAAGCAAAAA AAGAAGAGGGATGAGAAAAAAAAAAAAAAAAGGGCTAGCCCTCCAGAAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1206488: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064882327567AA556115TENF0441T.cruzi epimastigote normalized cDNA Library


Date: 5:58:48 on Sun 19 Nov 117.