EST 1206494 is a singleton


Sequence

>1206494 (1 EST) Length=380 ACTTTTTTTTTTTTTTTTTTCTTTACGCCCTTACATGGGAAACTGGCCAACAAAAACAAACAAACAAACAAAAAGCAGCG CTTCACCTTCCTTTCCACGTCCCCCTTTCTCCCCCCTCTTAGTCAGGTGTTGCAATACATACATGTCCTTGCTTGTCACG GCACCGTTTCTCTCCAGTGAAAGCAAAAAAGGCAAGGATAATCATTCCTGCCAATAAATCCAAAGGAACAGACACATAAG CAAAGCAGAAAAACAAAAAAAAAAACAAAGAGTGCTGCAAACCGAGATTGCATCATTCCCCCCTGACAAACCCACACGCA ACGGGGCTCAACAAGAAGGCTTTTTAACATCTCTGNTCCCAACAACAACCCGGCACGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1206494: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064942327573AA556121TENF0447T.cruzi epimastigote normalized cDNA Library


Date: 2:36:21 on Thu 23 Nov 117.