EST 1206502 is a singleton


Sequence

>1206502 (1 EST) Length=357 GCACGAGGTTGAAAGACGCGGTTGGTCCGGGCGCTGGTTGAATACCGTCAGCCCTGCGCCAACAACAACAACAACAACAA CAATCCCGTGANGAATACATGGCTGGCACTTGGATTCCCCCGACAATACGGAGGCAATGAACCCTGGCGTACAACGCTGA GGCGGCCGGTGGTATTGCCAGGGGAGCGGTCTCCAGTTGGGCTCTGCGCTTTGCCCTGGAGGACCCCGGGTTGAATTTCA CTCGGGGTCCGCCCACACGGCCCGAAGTAGTGTGGAGATGACTGGCTGTGGCTCCCCCGTGCGACAGGCCCGGATAATTG ACCGTGATTCAATGGATGCCAACTTCCGCATGTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1206502: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12065022327581AA556129TENF0468T.cruzi epimastigote normalized cDNA Library


Date: 15:1:34 on Wed 22 Nov 117.