EST 1206509 is a singleton


Sequence

>1206509 (1 EST) Length=293 GTGCATCCATGCCCTACCGCGCAAAGGATCATGAGGCCACACCGTTTGTAAATCACGCGAGCCTTTTCTTCCGTGAGGTG TTGGCGGCACTCCTCCGCTGCTCCTTTGACGGCATCAACACTTTATGGTGGTATGCATGACGCGAGTGCGGTGCATTCAG TCAGGCGTACCCTGCGATGGGCATGTTGGATCAGCGAGTGCGGGCCTCAAGCGTCTCGCAGCCATACAGCGTCAATGTCG TCGGCGAGCGTATACAACCCTGNCTCTATGCAAGGTGCCCTCGGCGTTGCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1206509: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12065092327588AA556136TENF0479T.cruzi epimastigote normalized cDNA Library


Date: 8:37:43 on Fri 24 Nov 117.