EST 1206513 is a singleton


Sequence

>1206513 (1 EST) Length=445 GGCACGAGGGGCGCCGGTCCGAAGGACAGCAGTCGTAGGGTTCGGTTCAGCTCTGCCATGTTCATTGGGCTGAAGTTTCT CGTATTTGTCAGGATCGGTGGCGGCGGGCAGGAATTTGGGTGCCGTGTTGCTTTTGCCGCCCACGGCTTTGTGTGGCCGA CGTTCCGGTGTCTGCTGAGCATTGGGCCATCTGCTTTCATGGCTGGCATGCTCAGGGAGCGAGTGGCATACGCACGGCGT ACTATCTGCCGGCTGTTACCGTCCGCGGACTCAAGTTTGGAGAGGAACGTGCGCCAGCGGCTTTTGGGTACTTCGCGCAA CACTTCTCTGTGACGGAATTTGAGCCGCTNACTGCGTTCTGCATGGGGTGCGGCGGCAATTTCNCAATCCGGCTCCGCCA GCTCTGGGGTCCAAAATGGGGGANAAATGGCGGTTCCTGCCTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1206513: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12065132327592AA556140TENF0065T.cruzi epimastigote normalized cDNA Library


Date: 0:33:36 on Fri 24 Nov 117.