EST 1209736 is a singleton


Sequence

>1209736 (1 EST) Length=318 GGCAATTCCTCTACATGGGCAACTCGACTATCGGGACCAACTCTGCTTTCATCTGGTACAACCAAGCAGTGGCCCGCATC GGTGTCAACGCCGGTGCTTCAAATGTGAGCGCCACCAGCTTACCGGCGGTCAACACCTGGGTGCTTGANTTTGTAACTCG CACGCAAACGGCCGGCGGCCGAATGGTTCTCAGTCTTCACCGCCGTTACGCCACCGACACCTCCTTCACNTCCTTCACCG GAAACGGCTCAGCGGCAGGCTATCCTGTGGGCTTCAACAAAATAAACCTCGGCCGCTACTGGCGGCTGGCGCCCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097362330025AA559820MU001004.NH3York-Harrop-lung-A


Date: 10:3:9 on Fri 24 Nov 117.