EST 1209737 is a singleton


Sequence

>1209737 (1 EST) Length=478 GAAATTTTTAATTNCGCCGGTGAAAATGTTCTTCGGCAATTATTTCGTTATTACTGGCGAANAAACACGCCTTTTTCAGA TAACTTGATCATCAAATGCTCCAGATATCTGCGCACCGTGNAAGTGCGCAAAAAGATAATAAATGGGATATACTCTAAAT AATTCGAGTTGCAGGAAAGGCGAACANGCNATTGAATCCCCAGGAGCTTACATAANTAAGTGGACTGGGGTGAGCGAAAC GCCAGAACGCAGCACATGGCAACTTGGAAGTTNTGAACGAAGNAATATTTACAGCATGTTTCCAGCCGAATCAGCATNTT TCCACCACCACACGGCCGAGGGGTGANTATGCCACCNGGNAANGGTTAAATATCGTCCGTTACCGCNCCCGAACCCAANC CACCAGGAATTTAATNTCGNTTATAACCCNCNCCCAANANATGAACGGAACCTGGCCGCCGCCGCCANTANTGAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209737: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097372330026AA559821MU001005.NH3York-Harrop-lung-A


Date: 19:5:39 on Sun 19 Nov 117.