EST 1209738 is a singleton


Sequence

>1209738 (1 EST) Length=251 GGCACTTCACTATCCTATGTACTATGACTACNACATTCAGAACTTCACCAAGCAACGCCTCCATGAGACATTAGAACCCG GTCAAGAGACTTCCCTTTATTACAGATTCAAACCCGCTCTCGAATTAGCCGGTCGATCTTTTGACCTGTCTATTGTTGTT TACTATCACGACAATAATGACNTTTATTATGCTCATAAGTTATTTAATCAAACTGTTAACTTATTTGAAATCGANGAAGG TGTAGACACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097382330027AA559822MU001006.NH3York-Harrop-lung-A


Date: 17:23:29 on Wed 22 Nov 117.