EST 1209740 is a singleton


Sequence

>1209740 (1 EST) Length=405 GCAATATGTCACNNGTTGTTGAGTGTTTTGTTTGCAAAATTATTTTTTGTGACCAANAGACCTACTGGTAAACATGTTTA CGAGGAACNACTGTCACAATCCGTGTTANAACTTCAACTGCTGGATTTCAGTAATGAATAANAATAACATTCAAAAATCT GTTGAAAAGTGTGTCTAAAATAAGCAAAAACCCAGGCATACCATCTACAAATCAGGGCTTCCGAATGTTTTTGGTTAAAA GCATCCTCGTCTGAATAAGGGCGTTATAGTTATTAAGGGTACCGCCTCAAAAGAAAATCCCNCTAATAAGGGCTTATTGC GAATGTTTTGGTCAAACCTCCATGAACTCCTTTTGAATTTAATTCGGGCATGAAAACCGGGTAAAAAAGCATTTGNAAAA TGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209740: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097402330029AA559824MU001010.NH3York-Harrop-lung-A


Date: 3:59:54 on Sun 19 Nov 117.