EST 1209746 is a singleton


Sequence

>1209746 (1 EST) Length=314 GGCAAATACTTTAGTCTTTTCAACTTTTCAACTACAGTGAATTGAATCGTTCGAATAACCCTCAGAATCAGTGCACCAAA GTGTGTAGTGGTTGATAAACCCTCCGTATCTGTCTCATCAATAAAGCTCGAACTGTTGGATATCCAACATTTATATATCA AGTCTACTCCTTACNAGCAGTCAACCTCTGAAGTTTGTTACCGGCTGAGTTCGTCCAAACAACTTCGCTGGAGTCCTTTG GGAGAAAACTTGACGTTTTTGAGGACTCGGCGATATTTCATTTTTTTGCCGTAATGCGTAGTCACTTCACTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209746: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097462330035AA559830MU001027.NH3York-Harrop-lung-A


Date: 2:30:27 on Mon 20 Nov 117.