EST 1209749 is a singleton


Sequence

>1209749 (1 EST) Length=307 ACCCTGCAGTCGAACGGGCGGTGTGGTTGAAAAAAACGCTTTCAACGTATTTGATGAAAGATGGGAANTTGTGCGACAGT ACGCAAATGAATGAAACAGGTGGTTACTGCCGCTGGGTTGCACAAATGATAACTTTTACCGCGTCGGGATGTGACAAGGC GGAANTCTCGGTCACGCCAAATCGACACCCTATAACGGACAAACAGTTACACGATATGGTCGTGCGTGTTGATACCAGCA GTATGCAGCCAATCGATTCTACTTGCCGGTTCCAGTACATACTGAATGAGTTGTAGCCCTTAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097492330038AA559833MU001032.NH3York-Harrop-lung-A


Date: 9:40:53 on Thu 23 Nov 117.