EST 1209752 is a singleton


Sequence

>1209752 (1 EST) Length=248 CTTTTTATCTACTCTACTTTATTATACTCATATATGTAACTATTTATGGTCATAATTATGTTGTTGTATTGATTTNGTTT GCTTTNGTTTTTGTTTTTTTTNAAATAAACAAAACACGCTGCAGGTCTGTCTTTCAATCCCCTTTTAAAAAANAAGGAAN AACCAACATCAATATAAACTATTTACTTTGAATAACTTGTCATTGCATTTTTTNCTTTTCTTGGTTTAGCAAAATTATGA TACATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209752: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097522330041AA559836MU001038.NH3York-Harrop-lung-A


Date: 14:18:16 on Mon 20 Nov 117.