EST 1209754 is a singleton


Sequence

>1209754 (1 EST) Length=306 GTTGCCGATTGGCAGGTGAATTCGCTTCTGGGTGTCTGAGGCCGCAAATCCGGGCAGCCGCNACGCAGGCTGTTGGCGCG GAAATGGCGGTGCAACCAAAGGACGCCGCGCGAGGACCTTCGACCGCCGCGAAGGGCCGATCAAANACAGGCCGCAGGAC CTGTGCAGGGCGCAATGACATCACCTCGGCTAAGCTGCGGCACCTTTCTTCGCGCACGGCCATGCATCCCTTCCCGCTAC CTGTCTCGGCACCTGATCAACTCGCCTACCGACTGCTGCAGGACAGCGACTGGGCCCGTTCGGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209754: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097542330043AA559838MU001044.NH3York-Harrop-lung-A


Date: 21:49:20 on Mon 20 Nov 117.