EST 1209755 is a singleton


Sequence

>1209755 (1 EST) Length=285 CAGAAAGTGTACTTTCTAAATCACACAATGTTCTAGCATTCACTGGTGCTGGTATAAGTGCTGAAAGTCATGTCCCAACC TTTANAAGATCTGGTGAATCATGGAGAAATTTCCATACCCAGGTGATTTCTTTAAAAATGGTTGTGAAAAGACTTATTTG AAGGATCTTGCTACACCCGATGCATTTCATTCAAATCCTGGTTNGGTTNGGGAGTTTTATCATTACTGTCGTGAAGTCGT CCGTTCTAGATGTCCTAATGCTGGACATTTAGCTCTTGCCCATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209755: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097552330044AA559839MU001045.NH3York-Harrop-lung-A


Date: 6:2:55 on Wed 22 Nov 117.