EST 1209756 is a singleton


Sequence

>1209756 (1 EST) Length=350 GAACAAATGTATTCTTTGATCTCCTCCAACCAGCGCCACCCAACGNAACTTTATTGAAATGGTAATTTGTGCCCATCTCC ATAAGCCAGCCCNTTATTCCATACTCTGGTCAATATATCCTTTTAGCATGGCCGGGGAAGCTGTACCACCAGANAGGNAA AAACCACCANTNACGTGTCATGGTTCAAGCAGCTCTGAAATAAAGCTGAATGAAACCTCTGGGAGAAATAACGTTTATCC ATATTCTTCCAGTTCTGGGTTCATCTTCCGGGGTTCATCACTGGGTTGAAAATTACGCCGAATATAAATCGAGTNCCGTC ACCTGTTATTTTCCGCTCCATTGGCCCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097562330045AA559840MU001046.NH3York-Harrop-lung-A


Date: 2:39:19 on Wed 22 Nov 117.