EST 1209758 is a singleton


Sequence

>1209758 (1 EST) Length=262 TCGAAGCAATATTTATGGNCTTATCTGATTTCACATTCGCCAATTGAGACAATTTCACCGGCAACACTACAATCTCTCAT GATAACTAATCATTCAATGAAAGATATCACTATTTTTATCTGTCAAGTAATATCATATATACCTGTAAAAATTTTAGTGA TATGTNGGATTATTTTATGTCGGTTAACTATNGGACCAGCAGTATCTAAATTAGGAAATAAATTACAACGACAACAGCAA TCTCAAAATCAACACTCAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097582330047AA559842MU001051.NH3York-Harrop-lung-A


Date: 13:29:14 on Wed 22 Nov 117.