EST 1209761 is a singleton


Sequence

>1209761 (1 EST) Length=279 TTACCTACTGGTGCCCGAAAAATTATGAAATCAGCTTGAGCAAGATTTACGAACTAAACCGATTTGTCTAATTGTCCTTG GTANGGCTGGCTCAGGCAAAACGACNTTTGTAAAGAAGCTAAATGAGTATTTAACAGTTTCATCAAATTCGTCGTATACA ATTNNTTTAGAACCCAGCAGTCCATCATATNCCGTACAATCCTAACATTGGATATNCGCGAATACTGTCAAGTTTTAAAG AGGTTATGAAAACAATATGGTTATGGGACCNAATGGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209761: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097612330050AA559354MU001059.NH3York-Harrop-lung-A


Date: 12:35:47 on Sun 19 Nov 117.