EST 1209764 is a singleton


Sequence

>1209764 (1 EST) Length=336 CCTGTGCGTAAAGCGATAGAATGTGAGATGCATCATGTCATTTCTTTTGACGGCTCGTATGTCAATTATCGTCACCTGGC GTTGNTTGTGTGATATTATGACTGTCAAAGGACATCTCATGGNCTATTACTCGGCATGGTCTTAACCGTTTGGGATACGG GAGCTTTANCTCGTTTGNTAGTTTTGAAANAAACAGTTGAACATACTTATGGAAAGCTGCTATCCATTCTGAAGTGTGAT CCAATGGGCTGGTGTTCTCAAAAACTATTATGCTTGGTCAACTGGGCTAAAATTGGGACAGGTTGTTTTTGAATTTGGCT TCTGGGATTCAGCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209764: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097642330053AA559357MU001074.NH3York-Harrop-lung-A


Date: 3:52:1 on Sat 18 Nov 117.