EST 1209766 is a singleton


Sequence

>1209766 (1 EST) Length=383 CCCAATCCATTTTTAAACCAACAACAACCAAATTCAGACAATCCCCAAGTTCAGAATCCTGGTCAGTGTGCATCACCAAT TACCCAGCATCAATCCCAGCTAAATCAAGCTCAACCTTATAATAACCTCAAACAGCTGGGCAATGGAGTTGGGAACTATG AAAAATTTGTNGGATGTAAAATATGGTGACCCATCCAAACAAGTTGGTTTCAAAACTAGCTCGAACCCACCCAACTATAA TGCATTTCAATCCTCAAGGGAATGTCACTAGAATACTGGTCGGGTGGAAAAGTTATCTTCTGGCCTCTCATTCCAAACAA CGGGATCTCTGGGTACAAAATTTTAACCATGGGAAATGCCAATGGCTCATGCCACAGCACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097662330055AA559359MU001077.NH3York-Harrop-lung-A


Date: 14:14:48 on Sat 18 Nov 117.