EST 1209770 is a singleton


Sequence

>1209770 (1 EST) Length=284 CCGTAGTTGGTATCGCCGAACGCGGCGCGGACCTTGCCGTAAAACTGCTGCATCGAGCCGACCACGGTGCCATGCTCGGC AGGCTTGCCACCGCTGGCTGCAACCGAGCCACTCAATGCGGCCACNATGCGGCCCTTGAACGCCGGCAATGNTATTNANN AGGGGCCGAAAGCTCGGCGTCCTTCACCTTGGGTCGCGGGCTTCTTCATAAAACNAACTTGCCGTCACGGGCGAATCTCG ATCAGGGTCGTTGAAGGCGAATGTTTCGATGGGTGGAACTGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097702330059AA559363MU001087.NH3York-Harrop-lung-A


Date: 12:43:10 on Fri 17 Nov 117.