EST 1209772 is a singleton


Sequence

>1209772 (1 EST) Length=316 CTGGTTTCTAGTCTCTCTATCAATTATGAAATTTTAATACTTCAATTCATGAGTCGATCTAAGCTAAACAATCATTGNAA AACCTGGNAAACACTGAAACGGCCGTTTCGCACTAANATGGAAACAACTCGGCTGTGTGAGTCCATGAATCGAGCATGCG AGNTTTGAAACAAAGANCCTTCGNATCTCGCGCGCAAACGCTTAACATCTAAACCGCTGAAACCGGCTGGTCATCCAACA GTGTTTATTGTCTAACTTCAATNGGTTCATGATCTTGTGTCAACACTCAAACAAACACTTCACTTCTACCCGAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097722330061AA559365MU001093.NH3York-Harrop-lung-A


Date: 13:23:0 on Wed 22 Nov 117.