EST 1209773 is a singleton


Sequence

>1209773 (1 EST) Length=239 AAATTTAAATAATNCCAAAGTTTCGNCCAGCAAACTTGTATGGNACTNCTTCGGGNATAATTTCAATCCTCTGNAGATTA TTTCCAATATATTTTTCATGTATAATGGGCTTCTCTATACTCTTCGCNCAATTTCTGGTTAAACTATTTGTTTCTGATAT TGAACGAAATATTCGTTATAAATTATTTTCCAATAAAATTAGTCTTACTTTCCGTTGAAACCTATCGTTAAATTATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097732330062AA559366MU001094.NH3York-Harrop-lung-A


Date: 2:51:51 on Mon 20 Nov 117.