EST 1209774 is a singleton


Sequence

>1209774 (1 EST) Length=327 AAAATGTTATTGTGGTCGGTACTGTCATCGATAACAATAATAATACCGCTACCACTACATGTATAACTACTAATAATGCT ACTACTACTGGNNTCTGGCCGCTACACCTCTACTGACTACACGAACTCCTTATTCTATCAATGAAAATGTAATTAAACAT ATTGTCCAAATTATCATACATTTTATTTTCTGGGCAGAAATATCAGAAATTCATGTTTTGGGTTTGGCTTTTNCCTTTAC AACTAAATCATACTGAATTTGGTAAATTTTAATTTCGAACTGGTCCAAACTGTGTGTGTGTGCGTTCTGGTTGCATTTCT TACCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209774: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097742330063AA559367MU001095.NH3York-Harrop-lung-A


Date: 3:6:11 on Tue 21 Nov 117.