EST 1209775 is a singleton


Sequence

>1209775 (1 EST) Length=339 NACGCATCTATTTCGTGATTAGACCTTGCGATCTATCTCCCGAGTTTGTGCTTCAGCTCAAATCACTGCTCAATGATAAC AAGGAAAACCTCTTTTACGTTCATGAATGAAAAGTATATCATCATAAGACGCGAGCCGACTAGTTTTATCNGCAGATGTC TCAAGAAGTCAATTATATTTCATATGACACCAAAACTCGGCCAGCGGTTCTGTCTTTTGATGTTCATTCAGTTGCGATTT GAGGACTCAAAAAGTCAAAGTGGATAAAACCAACAGGATGGATTTCGTGAGTATTGTCTATTCAGCCATCTCTCTTCAGT GTTCGTTCGACCTGCGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1209775: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097752330064AA559368MU002002.NH3York-Harrop-lung-A


Date: 0:52:14 on Fri 24 Nov 117.