EST 1209776 is a singleton


Sequence

>1209776 (1 EST) Length=302 AAAAGCTTCGATATGATCAGTCTACATATATTGGCAGAGCCAAACACTTTTTTATTACNACTAATCCTTTGAATGCTTTC AAAACACCTGCTGAATTAGAAGAAGCAAGGACCATTGTNCATAATTATAGGATAGGGATTATTCAGCCTGGTTTAACTGT ANAAAAGCTTTGGCAGGCAANAAATGTGTACNACTCACCGTTTCATCCAGATACAGGAGAAAAAATGATNCTCATNGGAC GCATGTCTTTTCAGGTGCCTGGGAATATGTTTATNACNGGTTGTTTGCTACAGNTTTACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209776: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097762330065AA559369MU002003.NH3York-Harrop-lung-A


Date: 14:48:30 on Sun 19 Nov 117.