EST 1209779 is a singleton


Sequence

>1209779 (1 EST) Length=329 AATAATTCATTTCCTTATTTGTAATAAGTTCTGCACAATTTAACCCATAGAACAATAAAAAGAAACAAATCGCAGTACAC TTAATTATAAATTTTAAAAAAAAATTGAACAAGGGATAATAACNTAAATCTCTTCAAATTACTTATTAATTAAACATTAT GAAAAATATATAAATTCGATAATAAAATGATTATTGAAACAATTATTTTATTGGTCTACTTGGTCTTCATCACTTTCAGT AGTTATCGTCAATGGCTATACCTGTGGCATGAAACTAAATTATGTGAACCATAAAACAAACGAATCCCATATTTGGAAAG GCGATNCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209779: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097792330068AA559372MU002056.NH3York-Harrop-lung-A


Date: 8:22:22 on Fri 24 Nov 117.