EST 1209781 is a singleton


Sequence

>1209781 (1 EST) Length=309 CCAAACTAGACAGAACTAGTGCTTGGCGTGTACAATTAGCCATTCGCCTTTTGTCTGTTTGTCGTCTTTATCAATTAGGC CTGATCAATTGGGATTCATGTTGTCAAATTATTAGTTCATNCAATTGGCAATTATAACCTGCAGCCGATTGGATTCTTGA TCATATGACACCCAACTGTTTTATTTAATTGGTTACTANAGTTGTTATTGTTATTAATATTAAGTTTAATTATTGACCTT TCCAAAAACAATTATCTTGTTGACTTTTAATTTAAAATCCTCTTTATCAGTTATTTAATTGTTAGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209781: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097812330070AA559374MU002092.NH3York-Harrop-lung-A


Date: 3:43:51 on Sat 18 Nov 117.