EST 1209782 is a singleton


Sequence

>1209782 (1 EST) Length=325 CTGGTGTAACAGGTGCTCAGCGTGGAAATCGAAGCTGAAGATCCTCGTGAACGCATGTTACGTAAACGTATATCAGGCAC TGAAATCACAACAAGATCAAATTAGTGGAGCGAAATCTGGCGGGGGTAGTGCAGTTTTGAGTAATGCACCCGAGCCAACT GTTCCGTCCGCATCGAAAAAATATAAAGAATTCAAGTTTTGAATGAAGTAATGAAATATGCATTCACGGTTTGTTTTTGA AACAGAAAAAAACACTTGTTGTTTCATCACATCATTAATGTTAGAATTATACATACTTGAAATATGAACATACAGCAACA GAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097822330071AA559375MU002096.NH3York-Harrop-lung-A


Date: 18:27:4 on Fri 17 Nov 117.