EST 1209784 is a singleton


Sequence

>1209784 (1 EST) Length=204 CGGCACGAGGAGAGAACTAGTCTCGAGTTTTTTTTAGTCTTAGTACATATTTATACACCGCTAAAACTAAAAATTCTGTA AANATGCGTCACTTCCTACTTAACACCATCTCCATAAATATTTTAANAAAACTCAGGGTGGTGTCCATTTATGTACATCT CTGCCGATCTATTCAATAAAAATTTAAAATGAANTTTNCATAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209784: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097842330073AA559377MC260304.NA3TBRI-Saber-cercaria-A


Date: 6:34:54 on Thu 23 Nov 117.