EST 1209786 is a singleton


Sequence

>1209786 (1 EST) Length=339 AATTCGGCACNAGGAAAAAGTNANTACTGATAACTTACGGGACCTCTTATTAGACTATTAATCTATTTATATTCCTATGG TATAACTATTCAGTAACTGGATTATCTATATCTATATTCATCTTATTACTACCTTCATTTTGACCTATTGATTATTATTA TATGATTTATTGTTTCCTAAATTATNCTCGGTTTATTGAGTACTGTCTCCCACGCTTCCAGCCACGTTTGGCTTGATTTT GTACAAATATTATTTTCTATTTTATGGTATGATGTGGCCTGTCTGTCTGATATATAAACAAAGTATGCTTGAAATAAACN ATTCGTATTGCCGAGGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1209786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097862330075AA559379MC260309.NA3TBRI-Saber-cercaria-A


Date: 21:45:3 on Mon 20 Nov 117.