EST 1209788 is a singleton


Sequence

>1209788 (1 EST) Length=130 TCNTTACTGAGCAAACCTCNTGAAAAACCTGCGTTTCGCTCATGAGCTCCAAAAAGCAATGGGAAAACTGGACATCNAGG GGAAACCTGGTGGGCTGTCGGATCCAATANAGATTGATAACCCAGGAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209788: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097882330077AA559381MC260313.NA3TBRI-Saber-cercaria-A


Date: 22:47:8 on Thu 23 Nov 117.