EST 1209791 is a singleton


Sequence

>1209791 (1 EST) Length=329 CGGCACGAGCTCAGATTGATGGAAACTCTCAATACAATTGATAGTCNTATCGAAGCTCTCGAAAATGCTGGAACGAATGT CGAGGTTCTTAATGCCATGCGAATATGGATCAAATGCCCTGAAAAATGTTCACAAAAACATGACTGCTGATGATGTACAG AATATAATGGATGATATACAAGAAACAGCGAGATACTTGCCAGGGAAATCTCCAATGTAATATCTACCCCTATGGGTCTA AATGCNGACTACGATGAAAGATGAACCTTCTTCGTGAAACTTGAAANAAACTTGAGGGCTGAANGGGTGTTGAAACNAAA ATTGGCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209791: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097912330080AA559384MC260324.NA3TBRI-Saber-cercaria-A


Date: 19:22:58 on Sun 19 Nov 117.