EST 1209813 is a singleton


Sequence

>1209813 (1 EST) Length=299 GTTTATACGATGTTCCCCTTTCCGAAGCTCATTGGCGTGTTATGCTCTTTTCCAGTGTCGGTTTAGAAATAAGCTTAGCC TAAAATGCTTTCATACGGGCTCCCAGAATTATATACCCCTCATACCCATGGTATTAGACAAATCTACAAATGTTGAACGA TATTATGACATATATTCCCGTTTATTGAAGGACCGAATTATATGTCTTATGGGCGCAGTCACCGATGAAAATGGCTGGAT CGGTTATCGCACAACTCCTGTTCTTACAATCAGAGGACAAAAGGACCCCTATACACTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209813: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098132330102AA559406MC250418.NA3TBRI-Saber-cercaria-A


Date: 16:26:18 on Fri 17 Nov 117.