EST 1209815 is a singleton


Sequence

>1209815 (1 EST) Length=271 AGAAGATGAGATAAATACAATGGCAGCAGCTACNACTACCGGCTTAGTGTATACCTCTCCAGGAATGTTTAAACCAGGTG GCTGGAAACGTTGCGGCTTTGGTGGGTTAGCTGGATTTGCTGTTGGTACNATCGCTGTTACTGTTACAAGCTGGTCTAAA ATAAAACATATGCTTGGTGGATAAACNACAATATTGTAATTTTAATTATGTACATTGACATTTTATCTAGTATCCGAAAA AATTACTTTTTAAATATACCTTGNAATTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209815: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098152330104AA559408MC250420.NA3TBRI-Saber-cercaria-A


Date: 21:10:10 on Sun 19 Nov 117.