EST 1209819 is a singleton


Sequence

>1209819 (1 EST) Length=300 CGGGCCTTGNAACCTGGTGATCTTATCATTACCCTTGATGAGCAACCGCATAGCCGTTTCATCAGACGTCNAAACGACTT GATACACACCATATAATTATCACTCTCTGAAGCCTTGTGTGGCTTTCAGCGGACGATACGAACATTAGATGATCGGACAC TAGTGATAAATTCCAGACCCGGNGAGGTGTATACTAATAAGGATTTCCGTGCGATTGAAGGAGAGGGAATGCCAAGATAC NAAAACCCGTTCGACAAAGGCCGACTCATCATAAAGTTTGACATAGTATTCCCGAAGANT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209819: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098192330108AA559412MC250424.NA3TBRI-Saber-cercaria-A


Date: 15:51:41 on Fri 17 Nov 117.