EST 1209823 is a singleton


Sequence

>1209823 (1 EST) Length=354 TATTCGTTCGGCGGTAATCAACTGTGTGAAAAGTTACCATAAAACTGTCCCATATATTTACTTTANACCATGCGCAAACC ATTCTACTAATCCACAATATAACAATGCAACCGAGCCATATGAAGTATTCAAATCCCGTTTTGTGAATGCCTTTGATGAT CCAAAAATTGACGGTTGGTGGGCCAGGACATGGATGCANAGACTTCATCTANAANACGCCGTTCCTCCCCCTGAAGTGGT AATTAGCGGCCTTAAAGCTTGCAAACGCCTTAACNATATCGCCCTGGCCATAAGGTTTGTTGAATCTGTAAAATTTAAGT GCAAAGTTGCCAAAGGTGCTTGGGAATGGATGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209823: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098232330112AA559416MC250429.NA3TBRI-Saber-cercaria-A


Date: 5:5:44 on Sat 18 Nov 117.