EST 1209824 is a singleton


Sequence

>1209824 (1 EST) Length=314 CCAACCACTAACTGCTACAGAAGACTAAATAANTTTTTTGCACCGGGTGCTGTAAACTGGGACTTCCATGACAGATTTGT GGCAGTTCGCGTTAAAAACTTTGATGAAAAGAACACTTATATTGAAAACCGTATTCCATCATCTGCTTCTTGTCCCTATC ATGTTCTTGCCGCTACATTAGCGGCTGGGTTGGATGGTTTANACCGTCAGCTTGAACCACCACCTCCTGGCCAGAAACCA TCAGAAAGTAAAATTGAGAACCAAGTGAAAATGCTCCCAAGTAGCCTTCAGGAAGCCCTACAAAGTTTGAAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209824: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098242330113AA559417MC250430.NA3TBRI-Saber-cercaria-A


Date: 20:51:0 on Sun 19 Nov 117.