EST 1209832 is a singleton


Sequence

>1209832 (1 EST) Length=299 CACAAGTTGACGTTTATTGTCTGCAGCTTTGTTTGAAATGCTCCAGCGCTTCAGACTTTTAAGAACTCTTCCCAGATTAG TGCATACCTATGTACTTCCAATTCAATGCATCGCAAATAAACAACAATTGATAAGCTCACATAACTTAATNANTCTTCAA CCTAAGGCTGCTGAATACTAAGTTTATCCTCCCTGGCTCTGTTGGACTAATCAATTACGAACAAAAGTGAGTTCGAAACA CTCATTTCTGAAACACNNATCGGAATTGAAGCCAACCCNTTACNTTGCCATCTCTACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098322330121AA559425MC250439.NA3TBRI-Saber-cercaria-A


Date: 19:24:2 on Sun 19 Nov 117.