EST 1209844 is a singleton


Sequence

>1209844 (1 EST) Length=313 TAAAGAAATGGACAGGTTTACGCTGTATGGTAGGTACAATTCATGGNTACTGTCGATCACTTATCATAATAAAAGTTTGA TGAATATGTATCTGTGAAATGTAAGATGTCAGTCCACAGTTTACTGTGTTTTTTGTACTTGTGTATTTAGTTTACAGTAA TTTAGGTAAATCATCTATGTACATCAGTTAGTCTCTTTCAAACCATTTCCACTTTGACATTCTTCTTCATCTTACATCCT TAAACCATTGTACATTGAATCTACTTTGTAAATGTTTGTGTTATTTATTTACTGTCTACTGAACTGTAATGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209844: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098442330133AA559437MC260418.NA3TBRI-Saber-cercaria-A


Date: 17:49:19 on Tue 21 Nov 117.