EST 1209845 is a singleton


Sequence

>1209845 (1 EST) Length=133 ACTTCGGCACNAGCAGACAGCCCGCAATGTCTCAGCTCAGCCTACGCTCGTTCCAGCTGGGAAGTATGTCTACACTCTTA CAACCCCTTGGCGATCAAGGGCAACTAACAATAAGTGCATTGGCTCAGTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209845: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098452330134AA559438MC260421.NA3TBRI-Saber-cercaria-A


Date: 11:32:57 on Fri 24 Nov 117.