EST 1209854 is a singleton


Sequence

>1209854 (1 EST) Length=105 CGGCACGAGGTTGCATGTTATTATTATGACTCCAAAACCAGTTTCCGAAACAGAATTACNTGAATGGGGTAAATGTTTAC TNAANCCATCCGCTACTCTAGTNGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209854: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098542330143AA559447MC260434.NA3TBRI-Saber-cercaria-A


Date: 19:39:24 on Fri 17 Nov 117.