EST 1209860 is a singleton


Sequence

>1209860 (1 EST) Length=301 GTGAACCGGAAAATGAATACACGTAAAGTTCAACCGGAAAATTCCAAACTCTCTGATTTAGACGGTGNAAACTCGATCTA TGGTTGAAAAAATGATGTATGACCAACGTCAAAAAGAGCTTGGTCTGCCAACATCCGAAGATCAGAAGAAACAAGAAATG TTGAAAAAGTTTATGGCTGCTCATCCAGAAATGGATTTTTCCAAATGTAAATTTTCTTAAGTTTATGTTAATTTGAACTG CTGAAGAAACACAATCTTTTTGGTATTATTATATGATCAAAAAAGAAACTTTCACATCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209860: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098602330149AA559453MC260444.NA3TBRI-Saber-cercaria-A


Date: 0:13:28 on Sun 19 Nov 117.