EST 1209862 is a singleton


Sequence

>1209862 (1 EST) Length=368 CGGCACGAGTCACAAGGTCGTCTGATTTATAATGAAAGTTCCAGCTATGNAACTCTAAAACTAATGATATAGTTAATTTN GTTCAAGAACACGTACAAACTTTGAAATTAACCGAGGAAACCGCAGGCTAATGTTGAATATTCTGAACAATCTAAACATT GTCATATGCCGACTTTCTATAATGAAGCAATAGTTGATCATGCGGACAGAAACATTACCGAATTCGTCTATATCTCCGAC AATGACAGTTATAGAAACATCGTCTCAAAACTCGTCAAATTCTAGATCTCGTCCAATTAGACCAATATATCAAAGTTCAG TAACTCTGTCTAGTCATAATCAATCAACTCCTCATAATTCTAAATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209862: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098622330151AA559455MC260447.NA3TBRI-Saber-cercaria-A


Date: 12:34:42 on Tue 21 Nov 117.