EST 1209863 is a singleton


Sequence

>1209863 (1 EST) Length=312 GTCAATATGAACGNGTGAAAGATCCCAGATCATTCAAAGATCGACGTACTGTCTTTACAGGTGCTAATTATGCANAANAA TATCAACGTATTGCACCTTCACACATGTTGGTTATGACAGATGAAGGCTTCCAAATAGCTGGAGCCGCTGAAGGTGGAGG ACATTCAGCTGCTTCTGCACCTGGAACTGAAGTTCCTGTTGAATAAATAATTCTATGAACATTAATTATAGTAATGCTGC TGTCATTGTTATTGTCACCAGGATATATACCATCAATTATTTCTGATNCTTTGGCATTCCTTNACCTCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209863: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098632330152AA559456MC260449.NA3TBRI-Saber-cercaria-A


Date: 6:20:31 on Fri 24 Nov 117.