EST 1209866 is a singleton


Sequence

>1209866 (1 EST) Length=315 CTCGATTAATGATACTGATGTGCGGTTGGGGTGGTTCAGCATTTACTTCAGGGAAATTATTTCTTTTGGGTACCTATATT GGGTCCATATATTGGTGCAGTGATAGGGGCAATTCTTTATGAATTAACAATTGGTATACATCTGGAATCGTAAATCAATA TCATCTTCACCAGCACAAACAACTACACCATCTGGAGAGCAAAGATNTGATCTTGATTCACCTGGGAAATCTGGTTCACN TTTACTCACTCGGGGATTATGAAATTTCTGCAAGTAAATAATCGATACTGTACTACATTGTAATTGACATATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209866: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098662330155AA559459MC260454.NA3TBRI-Saber-cercaria-A


Date: 22:44:24 on Thu 23 Nov 117.