EST 1209871 is a singleton


Sequence

>1209871 (1 EST) Length=304 CACAGTGCGAGCTAACATCAGAACTGCTATCAGACATGTGCGGCAAAGTCCTCAATCAAGCTCACATTCAACAGGGNATT CCAACTTGTTTTCAGTGAAATTGGTGATCTCATCATTGATGTCCCCAAAGTGCCTGAGTATATCGGGCGTTTTATAGCAA GAGCAGTTACAGATGATATCCTCCCTCCCAAATTTATCGAGCTGCAGAGAAATATTCTATCTCAGGTTTCACCTAGTAGC AGTCCTCTTCAAACTGAGACAGTCAAGTCGGAAAACGCTAACACAGTCTCTACTACTTCAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209871: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098712330160AA559464MC260459.NA3TBRI-Saber-cercaria-A


Date: 16:28:49 on Mon 20 Nov 117.