EST 1209876 is a singleton


Sequence

>1209876 (1 EST) Length=97 AAATATGGCTGTATGTATATATATATATGTGTGTGTGTGTGTAAAAAACTAAGATGAGAATGAGAATTGTATAAATTTAT GGTTTATGGGTNGCNGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209876: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098762330165AA559469MC260466.NA3TBRI-Saber-cercaria-A


Date: 5:47:57 on Sun 19 Nov 117.