EST 1209878 is a singleton


Sequence

>1209878 (1 EST) Length=287 CAGCTTTATTGTTTATTCTAAATTTGGTGTACTTGCAGACAATTGAAGCATCATTTTTGCTAAAATGGTTTTGTCGATTC GCAGGAAATAGTTCAGTTTGCAAATTGTTTGAGTTGGTGAATCTTGCAAGAAAATGTTTCAGCGCTTCCGCTGTTTTACA AGTGTGTAAATTAGAATGTGACCGTATAATTCGAAAAGCATGTTGAATGTCAACCCTATAATGGCATGTAGGATGCTCAT ATGTTGGTACTTCAAAGTTTAATTTTATGTGAAACAAACCNTTTAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209878: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098782330167AA559471MC260468.NA3TBRI-Saber-cercaria-A


Date: 0:34:4 on Sat 25 Nov 117.