EST 1209888 is a singleton


Sequence

>1209888 (1 EST) Length=307 GTCTTCTGTAGAAGTTGTTCAACTTTCTGCGCCTTTACCTGAATTCTCTGATGAGGAATTCCGTGTGAATCATTCATTTT TTGTTTCAATTATATGGAAAGATTCTGTACCAATATTTCTTGGACATGTTACAAATCCANNAGATCAATATTAATCGTGA TATATTGAATAACGTGACNATTTCTCCTTGATATCTTGTTTTCAATGGACCTTTGAATGTNTTCTGTNTTTTNCCCANTA ATTTAAATGTAATTTTCCCTTNCGAAGTTGTTGATCAATGTAACTATNAATGAATTTTNTTNNGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098882330177AA559481MC260490.NA3TBRI-Saber-cercaria-A


Date: 19:18:41 on Fri 24 Nov 117.