EST 1209893 is a singleton


Sequence

>1209893 (1 EST) Length=314 TGCACACAATGCCTTTCCATATTGGCGTCAAAAGCGGTCATTTCGNTGCCAACCAAAACAGTTTCAATCTTCAAGTTCCA GGTTTCGGGCCAAGTGAAGGTGTTTACAATAATCGCATGGACCCTCGATATGGCAATATGAATGATGACTCTGACATTGA TAAACGCAATTTCANNGGTTCAGGACCGGGTTGGAATCAGGGAACANCATGGTTCACATTCAAATCGACGTGGTCACTCT AGCGATCGTGGTTCAAGTTTCAGATGAAGGAAGGCGTTAACAGACATTGGCGCCTAGAAAAAATTTNGTCCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1209893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098932330182AA559486MC270403.NA3TBRI-Saber-cercaria-A


Date: 0:22:2 on Sat 25 Nov 117.